Category Science

Answering Silly Questions

One thing I’ve always liked about science is that it allows you to answer a lot of silly questions, as well as lofty ones.

I don’t remember where, but I recently ran across the question of what would happen if you put a kitten in the Large Hadron Collider and accelerated it to some fraction of the speed of light. While that’s a very silly question, it’s easily answerable: the LHC uses magnets to accelerate charged particles; but since you can’t ionize a kitten, there’s no way to accelerate it using magnets. (Also, I haven’t checked, but I think the inner ring where the particles actually spin and do their thing is too small for a kitten to fit.) If you came up with some other way of accelerating a kitten to .5c, you could also pick up any textbook on relativity to find out how it would be flattened, how time would slow down for it, and all that other fun stuff.

(For other answerable questions, see this list of Questions you hope students don’t ask. In fact, I remember asking my High School chemistry teacher how they get teflon to stick to the pan in the first place. It led to an interesting discussion.)

(Update, Jan. 25: For a perfect example of what I’m talking about, see this video of the Mythbusters exploring whether it’s true that you can’t polish a turd. I’m guessing that the measuring device seen at the end is used to tell shit from Shinola.)

Compare that to how religion deals with similar questions. Everyone’s heard stories of the “troublemakers” who ask questions in Sunday school, like “If I get eaten by a cannibal who then converts to Christianity, and the second coming comes and the dead get their bodies back, will the various atoms become part of my body, or the cannibal’s?” Or “Assuming everyone in my family goes to heaven, which is perfect, will my grandmother be the baby girl that her parents first loved, the young woman who my grandfather fell in love with, the middle-aged mother that my father remembers, or the old woman whom I loved?”

Too often, kids are told not to ask such questions, or are given entirely unsatisfactory answers (“It just is, okay?”). But if a belief is so weak that it can’t withstand honest questioning by children, is it worth holding on to?

Ray Comfort, Plagiarist?

Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio of Charles Darwin. Turns out that bio bears a striking resemblance to the first few pages of Comfort’s introduction (you know, the part that isn’t batshit crazy).

(HT Unreasonable Faith and AIG Busted.)

I find it ironic that the approach investigators use to detect plagiarism are similar to that taken by biologists to find homologies, which are one of the bits of evidence pointing to common descent.

So maybe Ray can use creationist arguments in his defense: “You cherry-picked your examples to make your case. If you look at the other 47 pages of the introduction, you’ll see that it’s nothing like anything Dr. Guffey has written”, or “Similarities do not mean that I copied from Guffey. It’s more likely that both texts were written by God.” Or the ever-popular “Did anyone see copying take place? Then how do you know it happened?”

(Cross-posted at UMD Society of Inquiry.)

Geek T-Shirt

I just had an idea for a geeky T-shirt:

In just seven days…

TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

SRY protein

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)

(Well, mostly.)

Kent Hovind’s Dissertation

I think I just came a little in my mouth. But then again, I’m a glutton for punishment.

Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot!

Those who lack the patience to read the whole thing may wish to read Karen Bartelt’s analysis.

(HT PZ.)

Thanks to No One

At this time of year, it’s traditional to say what you’re thankful for. And I’m thankful for a lot of things: that I know where my next meal is coming from, that I don’t have any debilitating diseases, that I have good friends and family… Heck, I’m thankful that the job I had to do after hours at work today didn’t turn into one of those nightmare jobs that wind up having you working all night.

But gratitude requires an object. To whom am I grateful? In some cases, it’s obvious: I’m grateful to my friends for putting up with me, and for doing all the things friends do. I’m grateful to my parents for raising me. I’m grateful to the nameless people who raised the food I’m going to enjoy tomorrow, the ones who hauled it here, and to the millions more who set up or aided the free market system that ensures that I have whatever food I want, whenever I want it.

What about the job tonight that went more or less according to plan? To a great extent, it went smoothly because I planned it carefully in advance. Should I feel grateful to myself, for having the foresight to solve a lot of problems before they came up, the experience to know what those problems are likely to be, and the knowledge to quickly diagnose and solve the snags that did come up?

Maybe. I’ve been known to do favors for my future self. But it still feels narcissistic.

And to whom should I feel grateful that I don’t have any debilitating genetic disorders? I suppose the obvious candidates are my parents. But they didn’t pick their genes, and didn’t decide how they would mix. They got lucky, as did I.

Shoud I thank the innumerable rocks flying around the solar system that none of them has decided to intersect Earth’s orbit and conk me on the noggin?

There’s an asymmetry here: on one hand, I can easily imagine an alternate universe in which I was born to parents who didn’t care about my upbringing and education, or one in which a stray C14 atom decayed at the wrong moment and gave me cancer at age five. And I’m glad for both. But in one case, there’s someone to thank, while in the other… the universe has failed to kill me, so far. It just worked out that way.

I guess what I’m getting at is that I have the same hyperactive agency detector as everyone else. Feeling grateful to some nebulous other for the random circumstances that went the way I like comes as naturally as seeing faces in clouds, and so I understand why people naturally believe in benevolent gods and spirits. And so I suppose there’s no harm in addressing thanks to someone or something for those things, as a way of satisfying an urge, long as it’s understood that that’s all it is. The universe. The flying spaghetti monster. Or, as George Carlin did, Joe Pesci, since he looks like a guy who can get things done.

So have a happy Thanksgiving, y’all. Don’t forget to thank the people — actual, living people — who have done something good for you, who matter to you. In fact, don’t wait until Thanksgiving, any more than you should wait until Valentine’s Day to tell your sweetheart you love him/her.

And if I hear you thanking Joe Pesci for the fact that the biscuits came out all right after all, I’ll understand.

(Update, Oct. 11, 2010: s/one/none/.)

The Sun Is A Miasma

They Might Be Giants’ new album Here Comes Science is all sorts of awesome. One of the things I like is the inclusion of both Why Does The Sun Shine? and a new song, Why Does the Sun Really Shine?.

The first one, a cover of Tom Glazer and Dottie Evans’s song, begins:

The sun is a mass of incandescent gas
A gigantic nuclear furnace
Where hydrogen is built into helium
At a temperature of millions of degrees

The second, on the other hand, tells us:

The sun is a miasma
Of incandescent plasma
The sun’s not simply made out of gas
No, no, no

The sun is a quagmire
It’s not made of fire
Forget what you’ve been told in the past

Why Does the Sun Shine? is a catchy tune, with a sciency theme that deserves to be included on the album. It’s also nice that They decided to record an updated version of the song.

But more importantly, aside from telling kids what plasma is, Why Does the Sun Really Shine? says that science isn’t static. New things get discovered, old ideas get discarded. And the fact that the old song is on the album is similar to the way that science doesn’t purge old ideas: there’s no heresy police whose job it is to raid libraries and rip out the pages of books and journals that talk about Lamarckism or phlogiston.

Rather, old ideas in science are like that 8 Gb drive I still have in my closet for some reason: yes, I used to use it: at the time, it was the best thing I had available. Then something better came along, and I stopped using it. And once I get over any residual sentimental attachment, I’ll eventually toss it.

(Well, there’s also the fact that since Why Does the Sun Really Shine? also says to “Forget that song”. So “that song” had to be included on the album to let people know what to forget.)

Happy Mole Day

As the Tree Lobsters remind us, today is Mole Day (the official site seems to be overloaded, but tehPedia isn’t). Yay!

For those who have forgotten High School chemistry, “mole” a word like “pair” or “dozen” or “score”, in that it refers to a certain number of things. But while “a dozen doughnuts” means twelve doughnuts, “a mole of doughnuts” refers to 6.02×1023 doughnuts (and, of course, a baker’s mole means 602,000,000,000,000,000,000,001 doughnuts).

6.02×1023 is known as Avogadro’s number (which is why you should celebrate Mole Day by having guacamole at lunch), which has the interesting property that that many hydrogen atoms weigh one gram. Oxygen, with 8 protons and 8 neutrons, has an atomic mass of 16 (minus some change), so a mole of oxygen weighs 16 grams.

This makes life easier for chemists. We all know that two hydrogen atoms and one oxygen atom combine to make one water molecule. And likewise, two dozen hydrogens and one dozen oxygens make a dozen water molecules. So two moles of hydrogen and a mole of oxygen make a mole of water.

So naturally, Mole Day is celebrated starting at 6:02 on 10/23 (US notation. Check with your local chemist and setting of $LC_TIME to find out when it’s celebrated in your area.

Update, Oct. 25: Alert reader Anne Wright pointed out a mistake. Fixed.

The “You’re Both Equally Wrong” Fallacy

Adam Weishaupt left a
comment
in another thread, and I’m conceited enough to think my reply is worth
reposting.

You know you will never agree, right?
This discussion can be likened with this: Imagine that there are only two people left in the world. One of them can only speak chinese, and the other can only speak arabic. No matter how much they talk with each other they will never understand each other. That is simply because they do not understand each others language. It is really the same with atheists vs christians or creationists vs evolutionists; the evolutionists leave out the possibility of the existence of God, so they can not understand the “language” of the Christians. On the other hand, the Christians leave out the possibility of the “non-existence” of God, so they can not understand the language of the atheists. Still, atheists try to prove their theories using their own language, and the same goes for the Christians.

You seem to be wrong on just about every point.

For starters, even using your analogy, I think you underestimate people’s ability to understand each other. A Chinese speaker and an Arabic speaker trapped on a desert island would, I’m sure, quickly work out some way of understanding each other.

the evolutionists leave out the possibility of the existence of God, so they can not understand the “language” of the Christians.

This is manifestly untrue. Kenneth Miller, the author of Finding Darwin’s God is an evolutionary biologist, the author of one of the standard High School textbooks in biology, was a witness at the Dover trial for the pro-evolution side, and is also a devout Christian.

Francis Collins, Obama’s choice to head the NIH, used to be the head of the Human Genome Project, is by all accounts a very good scientist, has said that even if there weren’t a single fossil, the DNA evidence alone would be sufficient proof of evolution, is also an evangelical Christian, and quite a vocal one. In fact, his book The Language of God is subtitled A Scientist Presents Evidence for Belief.

Hell, even in the ID camp, Michael Behe accepts common descent of humans with all other living creatures. I know this because I he told me personally when I sent him email about it.

It isn’t hard to find evolutionary biologists who are also Christians. You need to look around a bit more.

the evolutionists leave out the possibility of the existence of God

As shown above, this is patently untrue. And even if you meant to write “atheist” instead of “evolutionist”, you’d still be wrong. Read The God Delusion by Richard Dawkins, who is both an evolutionary biologist and a vocal atheist. In this book, which is all about atheism, he spends several pages making it quite clear that he does not exclude the possibility of a god’s existence.

I can’t think of a single atheist, either among the famous published writers or my friends and acquaintances, who categorically excludes the possibility that there might be a god out there.

You should also google “deconversion story” and read some people’s accounts of how and why they left their particular religion. You’ll find that in many, probably most cases, deconversion doesn’t happen overnight. It’s a long process that takes years. Often people give up each bit of faith only after a struggle.

Furthermore, most atheists, at least in the US, were raised religious and grew out of it. Many remember being believers quite well, so it’s not a question of never having thought the way a believer does.

On the other hand, the Christians leave out the possibility of the “non-existence” of God

Again, this is manifestly untrue. Every church I’ve ever seen has programs to help backsliders, help people strengthen their faith, ceremonies to help those who have stumbled in the faith to rejoin the flock, and the like. What does it mean to have “weak faith”, if not to admit the possibility that the god they were taught about doesn’t exist? In fact, the very existence of such programs and ceremonies tells me that even believers find it hard to believe in gods; that they want to believe, but often can’t manage to do so. After all, plumbers don’t have retreats to relearn to believe in water. Bankers don’t go to seminars to strengthen their belief in money. Yet theists apparently require these sorts of thing.

Or perhaps you’re saying that you, personally, are unwilling to admit even the possibility that there might not be any gods. That just means you’re closed-minded. You may want to work on that. It’s not a virtue.

(Thanks to
Eamon Knight
for the
title.)

Some Meta-Arguments Against God, Part 1

It’s widely acknowledged that it isn’t possible to prove absolutely
that no gods exist, any more than it’s impossible to prove absolutely
that no invisible unicorns exist. Every atheist I know freely
acknowledges that. But at the same time, one can easily argue that
gods (or invisible unicorns) are very unlikely to exist.

A lot of these arguments are meta-arguments, in that they don’t stand
on their own, but build upon arguments made by theists.

Lack of evidence

Despite what a lot of people think, atheism isn’t the firm belief that
there aren’t any gods. Rather, it’s a lack of belief in gods.
To put it another way, the atheist position is “You believers haven’t
made your case. I’m not convinced that you’re right.”

So the lack of evidence is the big one. There is no good evidence for
any gods. No verified miracles, no verified prophecies, no burning
bushes, no nothing.

There’s a saying that “absence of evidence is not evidence of
absence”. This is true as far as it goes, but absence of evidence
where we would expect to see some is evidence of absence.
If I say that there’s a Thai restaurant at 15th and K, the fact that
you’ve never heard of it doesn’t mean that I’m wrong. If, however, you
go down to 15th and K, and look all over, and fail to find the Thai
restaurant, that is good evidence that I’m wrong.

Theists have had thousands of years to demonstrate that their various
gods are real. And they’ve tried. Oh, boy, have they tried. And so
far, bupkis. No divine abodes on top of Mount Olympus, no rainbow
bridge to Asgard, no Noah’s Ark, no nothing.

Okay, so maybe gods aren’t directly detectable, either with our senses
or simple measurement devices. Maybe they don’t reflect visible light,
or emit sound waves, or pull compass needles toward them. That still
leaves indirect evidence.

I’ve seen satellite photos in which you couldn’t see ships, but you
could see their wakes. A lot of extrasolar planets have been
discovered not by direct observation, but by they affect the orbit of
their sun. Heck, if it comes to that, all nuclear physics is done
through indirect observation: protons and electrons are too small to
see, but we can observe the shape of trails in a bubble chamber, or
flashes of light on a CRT.

It’s not just the so-called hard sciences, either: there are
statistical methods for figuring out whether an election was rigged by
looking for anomalies in the results, the sorts of things that would
be introduced by a cheater, but unlikely to come up by chance.

And yet, nothing. No good direct evidence, no good indirect evidence.
The Templeton Foundation keeps throwing money at trying to come up
with evidence of a god — studies on intercessory prayer, that
sort of thing — and so far they’ve come up with two kinds of
results: ones that come from flawed experiments, and ones that show no
effect.

I don’t think it’s just me being overly skeptical: after 2000 years,
Christians have still failed to convince two thirds of the world’s
population that they’re right. Jews and Hindus have had even longer.
Miracles of Islam
are not convincing to anyone but Muslims. And so on, and so forth.

CreoZerg Rush!

For those who, like me, didn’t manage to make it to Ken Ham’s
Creation Hebrew Mythology “Museum”
for the
Student Secular Alliance‘s
Zerg rush,
you can read the raw twit log
here.

Some of the highlights are collected at
Attempts at Rational Behavior,
but I’m sure that more will follow.

I’m not sure who first twote that “Adam sinned so I could enjoy bacon”, but now I want that on a tee-shirt.

Local 12, a news station in Cincinnati, has a
brief story
about this, with nothing of real interest.

The MSM is obviously engaged in a coverup, since Google News doesn’t
show any reports of hundreds of baby-eating atheists raping and
looting their way through the Kentucky countryside. And Cephalopod
Überhauptmeister PZ Myers is
in on the conspiracy.

Update: 17:04: PixelFish’s LOLCreashun and Dino Haiku.