As I mentioned earlier, I asked commenter Flabberghasted for money, and he came through. Which left me with a not-terribly-fungible Amazon gift card, and the question of what to do with it.
I wound up taking Shelley’s advice: used the card to knock $50 off my Christmas shopping, and then made a $50 donation to the Secular Student Alliance. Because today’s students are tomorrow’s future that the Terminators will come back in time to try to undo. Or something like that.
Because USian media outlets don’t seem to have reported this story:
Prague – The Czech government today set the drug possession limits under which the possession of up to 1.5 grammes of heroin, up to one gramme of cocaine and up to two grammes of methamphetamine (pervitine) will not be punishable as of New Year.
Czechs will also be able to legally possess up to 15 grammes of marijuana, according to the Justice Ministry’s proposal approved by the government today.
Follow the link to see a table showing how much of what is allowed.
The AP is reporting that Oral Roberts is dead at 91. I guess he failed to raise the $8 million ransom to keep the Lord from calling him home.
The obit also mentions Oral Roberts University’s financial problems. Maybe they could join with Bob Jones University to form Oral BJ U. (Might not want to invite Brigham Young U. into the coalition, though. That might turn out to be… barely legal.)
Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio of Charles Darwin. Turns out that bio bears a striking resemblance to the first few pages of Comfort’s introduction (you know, the part that isn’t batshit crazy).
(HT Unreasonable Faith and AIG Busted.)
I find it ironic that the approach investigators use to detect plagiarism are similar to that taken by biologists to find homologies, which are one of the bits of evidence pointing to common descent.
So maybe Ray can use creationist arguments in his defense: “You cherry-picked your examples to make your case. If you look at the other 47 pages of the introduction, you’ll see that it’s nothing like anything Dr. Guffey has written”, or “Similarities do not mean that I copied from Guffey. It’s more likely that both texts were written by God.” Or the ever-popular “Did anyone see copying take place? Then how do you know it happened?”
(Cross-posted at UMD Society of Inquiry.)
I just had an idea for a geeky T-shirt:
In just seven days…
TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG
… I can make you a man!
(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)
(Well, mostly.)
I think I just came a little in my mouth. But then again, I’m a glutton for punishment.
Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot!
Those who lack the patience to read the whole thing may wish to read Karen Bartelt’s analysis.
(HT PZ.)
Luke 6:27-31 (NIV):
27“But I tell you who hear me: Love your enemies, do good to those who hate you, 28bless those who curse you, pray for those who mistreat you. 29If someone strikes you on one cheek, turn to him the other also. If someone takes your cloak, do not stop him from taking your tunic. 30Give to everyone who asks you, and if anyone takes what belongs to you, do not demand it back. 31Do to others as you would have them do to you.
This has long been one of my favorite Bible verses, especially with biblical literalists, because so few of them actually obey it.
Over in the comments on the Jo Hovind Update post, I asked Flabberghasted whether he obeys that injunction. He said yes. I asked him for a thousand smackers.
To my surprise, he came through. Oh, not the full kilobuck. But he did send me a $50 Amazon gift card. After I pointed out that this was an object lesson to illustrate that the passage above was not one of Jesus’ better-thought-out ideas. And in the credit-where-credit-is-due department, he didn’t drag his feet. The main delay was that I didn’t give him my email address as quickly as he wanted it.
So first of all, to Flabberghasted: thank you.
Secondly, while he gets points for consistency and obedience to Jesus. Unfortunately, I maintain that my point still stands, and being a doormat is still not a good long-term strategy for Christians. So minus a bunch of points for that.
I haven’t decided yet what to do with the card. As I said, I just got it, and am considering my options.
ID the Future has a new episode entitled Intelligent Design Turns 25. I haven’t listened to it, but the title alone is cause for contemplation.
25 years of “Darwinism will be dead within 5 years”.
25 years since the phrase “scientific creationism” was deemed too obviously religious to pass legal muster, and therefore in need of a pair of Groucho glasses.
25 years without a single experiment, testable theory, or, indeed novel argument.
25 years of whining about how the mean old scientific establishment doesn’t take ID seriously.
22 years since the phrase “cdesign proponentsists” came into existence.
20 years of evolutionary theory somehow still lurching forward, zombie-like, propped up by academic tradition, Vested Interests(TM), and of course, its enormous predictive power and ever-plentiful practical applications.
How time flies.
Oh, lovely. The Disco ‘Tute is suing the California Science Center. Technically, the suit is about the California Science Center (I was going to say “CSC”, but that’d be confusing) not releasing certain documents that Disco asked for under FOIA. But what really chaps their hide is that scientists have a bias against bullshit pseudoscience:
“We believe the reason the California Science Center withheld these public documents is simple: the e-mails show evidence of discrimination against the pro-intelligent design viewpoint.”
Yeah, I bet those mean mainstream scientists also have a bias against dowsing, astrology, and Bigfoot sightings, too. Mean ol’ poopy heads! Why can’t they consider all opinions to be equally valid, regardless of evidence or lack thereof?
To quote David St. Hubbins of Spın̈al Tap,
I believe virtually everything I read, and I think that is what makes me more of a selective human than someone who doesn’t believe anything.
