Monthly Reports with Org-Mode

Like a lot of people, I have to submit a monthly “bullet” report, listing the things I’ve done in the previous month.

Since I use Org-Mode for planning, scheduling, and organizing tool (or rather: I tend to throw a bunch of notes into a file and tell this love child of a day planner and a wiki to tell me what I should do next), I figured I should use that.

I could use the timeline feature (C-c a L), but that only works for the current buffer, and I want a report that covers all buffers, just like the agenda.

What I’ve done in the past is to use C-c a a to get the agenda view, go back a month, toggle displaying completed/archived/whatever items, and go through that to make my bullet list.

But I finally got around to encapsulating that into a single M-x bullet command:

; Make it easier to generate bullets for $BOSS
(defvar bullet-entry-types
  '(:closed)
  "Org-mode agenda types that we want to see in the monthly bullet report
See `org-agenda-entry-types'."
  )

(defun bullets ()
  "Show a list of achievements for the past month, for monthly reports.
Uses `org-agenda'.
"
  (interactive)
  (require 'org-agenda)
  ; All we're doing here, really, is calling `org-agenda' with
  ; arguments giving a start date and a number of days. But to do
  ; that, we need to figure out
  ; - the date of the first of last month
  ; - the number of days in last month
  (let* ((now (current-time))
	 ; Figure out when last month was. Assuming that I run this
	 ; close to the beginning of a month, then `now' minus two
	 ; weeks was some time in the previous month. We can use that
	 ; to extract the year and month that we're interested in.
	 (2weeks-ago
	  (time-subtract now
			 (days-to-time 14)))
	 ; We'll also need to know when the first of this month was,
	 ; to find out how long last month was. If today is the 12th
	 ; of the month, then the first of the month was `now' minus
	 ; 11 days.
	 (1st-of-this-month
	  (time-subtract now
			 (days-to-time
			  (- (nth 3 (decode-time now))
			     1))))
	 ; Ditto to find the first of last month.
	 (1st-of-last-month
	  (time-subtract 2weeks-ago
			 (days-to-time
			  (- (nth 3 (decode-time 2weeks-ago))
			     1))))
	 ; The length of last month is the difference (in days)
	 ; between the first of last month, and the first of this
	 ; month.
	 (len-last-month
	  (time-to-number-of-days
	   (time-subtract 1st-of-this-month
			  1st-of-last-month)))
	 (start-date (decode-time 1st-of-last-month))
	 (start-year (nth 5 start-date))	; Year number
	 (start-mon (nth 4 start-date))		; Month number
	 ; Restrict the agenda to only those types of entries we're
	 ; interested in. I think this takes advantage of dynamic
	 ; scoping, which is normally an abomination unto the lord,
	 ; but is useful here.
	 (org-agenda-entry-types bullet-entry-types)
	 )
    ; Create an agenda with the stuff we've prepared above
    (org-agenda-list nil
		     (format "%04d-%02d-01"
			     start-year
			     start-mon)
		     len-last-month)
    ))

I hope this proves useful to someone.

AI vs. EC

Since the 1940s, computer scientists have been seeking to make machines perform the same kinds of tasks as humans. This pursuit of artificial intelligence (AI) has yielded a lot of impressive results, such as Deep Blue beating a chess grand master, but it has fallen short of people’s expectations: computer translation, for instance, is still a long way away.

And so computer scientists started emulating evolution by natural selection, a process about as far removed from intelligence as possible: try everything and see what works. A process so amazingly stupid that even inert, nonliving material cam perform it. This research seems to have succeeded much better than anyone expected.

Which just goes to show that artificial intelligence is no match for artificial stupidity.

iPhone Keyboard Trick

I’d noticed a while back that if you hold down a key on the iPhone keyboard, such as the ‘E’, for a second or two, you get a pop-up menu with variations on the ‘E’ theme, like ‘é’, ‘è’, ‘ê’, and so on.

But what I hadn’t noticed until just now is that the “.com” key, which appears when you’re expected to type in a URL, exhibits the same behavior: if you hold it down, you get a popup menu with “.net”, “.edu”, “.org”, and “.com”.

In addition, since I have the French keyboard installed, the popup contains “.fr”.

In the email application, when you’re entering an address, there’s no “.com” button, just a “.” (period) button. However, it also has the domain popup, with the same TLDs as the “.com” button.

I’ve gotta say: it’s little touches like this that help the interface get the hell out of the way of whatever it is you’re trying to do.

Observations on PS3 Pricing

I just noticed something odd in the price of different Playstation 3 models: Amazon.com’s PS3 page has:

Playstation 3, 120 Gb: $299.99

Playstation 3, 250 Gb: $414.99

From this, we can work out the price per gigabyte: ($414.99 – $299.99) / (250 – 120) = $0.8846 $/Gb.

That’s not the odd part. Since I have some old Playstation 2 games, ideally I’d like a PS3 that’s backward-compatible with the PS2. According to Wikipedia (which can be relied on, here, since it’s a nerd topic), those are the 20 and 60 Gb models, as well as some 80 Gb ones.

Again from Amazon, we have:

Playstation 3, 20 Gb: $229.99

Since this has 100 Gb less than the 120 Gb model, we would expect it to cost 100 × $0.8846 less, or $211.53. But it costs $229.99, or $18.46 more. So that $18.46 must be the price of PS2 compatibility.

Now we get to the odd part:

Playstation 3, 60 Gb: $849.99

We would expect this to cost $299.99 (the price of a 120 Gb model), minus 60 × $0.8846 = $53.08 because it has 60 Gb less storage, plus $18.46 for PS2 copmatibility, for a total of $265.37. So why is the real cost over $500 higher?

All I can figure is that the 60 Gb disk is a lot bigger than a 20 Gb disk, leaving less free space inside the case. So the PS2 compatibility has to be built out of smaller components, which are vastly more expensive.

Network Problems Fixed?

As far as I can tell, FreeBSD 8 tickled something in the driver for my ethernet card, and caused it to behave unreliably. Rather than muck around with half-tested kernel patches or ifconfig settings, I slapped a $30 Whatevertheyhadontheshelf-3000 (read: common chipset that’s been debugged by a lot of people), and as far as I can tell, things are now working as they should. If the site stays up for a year, I guess we’ll know.

I also took the opportunity to add some memory. So whoo-hoo all around.

And while I’m at it, I should point out that FreeBSD is like a VW Bug: not the prettiest thing to look at, especially compared to various Apple or Linux offerings, but in a crunch it’s nigh-indestructible. Wanna run with a root partition that’s over 100% full? Sure thing. Boot a 7.2 kernel with a 8.0 /usr? No problem.

Geek T-Shirt

I just had an idea for a geeky T-shirt:

In just seven days…

TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

SRY protein

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)

(Well, mostly.)

Google Criticized Over Name of Its New Language

Slashdot has a story entitled Google Under Fire For Calling Their Language “Go”.

I can certainly understand that: Go has got to be the least-googlable language name since C.

Happy Mole Day

As the Tree Lobsters remind us, today is Mole Day (the official site seems to be overloaded, but tehPedia isn’t). Yay!

For those who have forgotten High School chemistry, “mole” a word like “pair” or “dozen” or “score”, in that it refers to a certain number of things. But while “a dozen doughnuts” means twelve doughnuts, “a mole of doughnuts” refers to 6.02×1023 doughnuts (and, of course, a baker’s mole means 602,000,000,000,000,000,000,001 doughnuts).

6.02×1023 is known as Avogadro’s number (which is why you should celebrate Mole Day by having guacamole at lunch), which has the interesting property that that many hydrogen atoms weigh one gram. Oxygen, with 8 protons and 8 neutrons, has an atomic mass of 16 (minus some change), so a mole of oxygen weighs 16 grams.

This makes life easier for chemists. We all know that two hydrogen atoms and one oxygen atom combine to make one water molecule. And likewise, two dozen hydrogens and one dozen oxygens make a dozen water molecules. So two moles of hydrogen and a mole of oxygen make a mole of water.

So naturally, Mole Day is celebrated starting at 6:02 on 10/23 (US notation. Check with your local chemist and setting of $LC_TIME to find out when it’s celebrated in your area.

Update, Oct. 25: Alert reader Anne Wright pointed out a mistake. Fixed.

Quick and Dirty Perl Hack: Is Foo::Bar Installed?

Every so often, I need to find out whether I have a certain Perl module installed. Usually it’s either because of a security alert, or because I’m wondering how much of a pain it would be to install some package that has Some::Obscure::Module as a prerequisite.

I don’t know how y’all do it, what with the plethora of package-management utilities out there, but one way that works for sure is simply:

perl -MSome::Module -e ''

If this command succeeds, that means Perl successfully loaded Some::Module, then executed the (empty) script, printing nothing. If Some::Module is missing, it’ll print an error message and fail.

This is short enough that it should be aliased, but I haven’t gotten around to that yet.

It’s A Visual Pune, or Play on Dots

(Whipped up in 10 minutes with the Gimp, so don’t complain about the quality.)