The Onion Can’t Keep Up

Onion headline, Dec. 22:

Weed Delivery Guy Saves Christmas

Associated Press headline, today:

Search of car turns up gift-wrapped marijuana

Ack! Missed Milestone

I just happened to notice that that last post was #666, a milestone of sorts. I’d meant to commemorate it with something suitably satanic, but missed it.

Anyway, enjoy post #667, the Neighbor of the Beast.

Sing Like You Mean It

What with it being late December and all, I’ve been listening to a lot of Christmas music lately. And one thing I’ve decided is that I really need to separate my collection into “Christmas music (straight)” and “Christmas music (ironic)”. It hurts my brain when I put the MP3 player on shuffle and it goes from Bing Crosby’s Silver Bells to William Hung’s version.

Another thing is that I need to purge my collection of such schmalzy glurge as Christmas at the Dentist’s and Stuck in an Elevator for Christmas.

Which brings me to my main point: that playing or singing like you mean it counts for a lot. I just listened to Etta Jones’s Have Yourself a Merry Little Christmas. I can’t think of a single objective criterion (tempo, syncopation, inflection, etc.) by which it should be excluded from An Uncool Square’s Treasury of Easy-Listening Christmas Favorites, but I like it. There’s something I can’t define, but basically she sings like she means it, like it gives her joy to be singing this song, rather than singing like “hey, it’s a gig.” (And yes, I hear a lot of the same thing in gospel music, which is why it goes on my list of genres that I respect, even if I don’t enjoy the music itself.)

Mannheim Steamroller could easily have been a novelty act: A Synthpop Christmas. But I think there’s a joy that comes through in his playing, a feeling that he actually likes those songs, and wanted to do them justice in his own style. Ditto Bing Crosby and Frank Sinatra, though Dean Martin could get a bit too schmalzy for me.

Of course, singing like you mean it isn’t everything. Wing is quite earnest, as is William Hung. But that doesn’t mean I want to listen to more of them than I absolutely have to.

I completely understand people who hate shopping in December because all the malls are playing the same twelve goddamned songs for a solid month. I too put on my iPod to drown out the Extruded Music Product. But if you look, you can find performances of those same twelve songs (and a lot more) that actually sound good. To a large extent, I think it’s simply because the musicians have genuine love for the material.

(PS: for the people who are tired of hearing the same twelve songs over and over, every year I make it a point to listen to Navidades Radioactivas, a Spanish punk Christmas compilation. It’s definitely… different.)

Followup on Luke 6:30

As I mentioned earlier, I asked commenter Flabberghasted for money, and he came through. Which left me with a not-terribly-fungible Amazon gift card, and the question of what to do with it.

I wound up taking Shelley’s advice: used the card to knock $50 off my Christmas shopping, and then made a $50 donation to the Secular Student Alliance. Because today’s students are tomorrow’s future that the Terminators will come back in time to try to undo. Or something like that.

Drugs in the Czech Republic

Because USian media outlets don’t seem to have reported this story:

Prague – The Czech government today set the drug possession limits under which the possession of up to 1.5 grammes of heroin, up to one gramme of cocaine and up to two grammes of methamphetamine (pervitine) will not be punishable as of New Year.

Czechs will also be able to legally possess up to 15 grammes of marijuana, according to the Justice Ministry’s proposal approved by the government today.

Follow the link to see a table showing how much of what is allowed.

Oral Roberts Dead

The AP is reporting that Oral Roberts is dead at 91. I guess he failed to raise the $8 million ransom to keep the Lord from calling him home.

The obit also mentions Oral Roberts University’s financial problems. Maybe they could join with Bob Jones University to form Oral BJ U. (Might not want to invite Brigham Young U. into the coalition, though. That might turn out to be… barely legal.)

Ray Comfort, Plagiarist?

Looks like Ray Comfort found it too hard to write a 50-page introduction to Origin on his own: Metropulse.com, a Knoxville, TN local paper, has a story about Stan Guffey, a University of Tennessee lecturer who wrote a brief bio of Charles Darwin. Turns out that bio bears a striking resemblance to the first few pages of Comfort’s introduction (you know, the part that isn’t batshit crazy).

(HT Unreasonable Faith and AIG Busted.)

I find it ironic that the approach investigators use to detect plagiarism are similar to that taken by biologists to find homologies, which are one of the bits of evidence pointing to common descent.

So maybe Ray can use creationist arguments in his defense: “You cherry-picked your examples to make your case. If you look at the other 47 pages of the introduction, you’ll see that it’s nothing like anything Dr. Guffey has written”, or “Similarities do not mean that I copied from Guffey. It’s more likely that both texts were written by God.” Or the ever-popular “Did anyone see copying take place? Then how do you know it happened?”

(Cross-posted at UMD Society of Inquiry.)

Geek T-Shirt

I just had an idea for a geeky T-shirt:

In just seven days…

TTTCGCATTCTGGGATTCTCTAGAGCCATCTTGCGCCTCTGATCGCGAGACCACACGATGAATGCGTTCA
TGGGTCGCTTCACTCTATCCTGGACGTTGCCTTTACTGTTTTCTCCCGTTTCACACTGATACTTAGAGTT
ACAGCTTTCAGTGCAAAGGAAGGAAGAGCTTCTCCGGAG

SRY protein

… I can make you a man!

(For those who haven’t memorized the human genome, that’s the SRY gene, which is found on the Y chromosome and makes embryos develop as males.)

(Well, mostly.)

Kent Hovind’s Dissertation

I think I just came a little in my mouth. But then again, I’m a glutton for punishment.

Kent Hovind’s “doctoral dissertation” at Patriot “University” has been released on Wikileaks. Grab it while it’s hot!

Those who lack the patience to read the whole thing may wish to read Karen Bartelt’s analysis.

(HT PZ.)

Luke 6:30

Luke 6:27-31 (NIV):

27“But I tell you who hear me: Love your enemies, do good to those who hate you, 28bless those who curse you, pray for those who mistreat you. 29If someone strikes you on one cheek, turn to him the other also. If someone takes your cloak, do not stop him from taking your tunic. 30Give to everyone who asks you, and if anyone takes what belongs to you, do not demand it back. 31Do to others as you would have them do to you.

This has long been one of my favorite Bible verses, especially with biblical literalists, because so few of them actually obey it.

Over in the comments on the Jo Hovind Update post, I asked Flabberghasted whether he obeys that injunction. He said yes. I asked him for a thousand smackers.

To my surprise, he came through. Oh, not the full kilobuck. But he did send me a $50 Amazon gift card. After I pointed out that this was an object lesson to illustrate that the passage above was not one of Jesus’ better-thought-out ideas. And in the credit-where-credit-is-due department, he didn’t drag his feet. The main delay was that I didn’t give him my email address as quickly as he wanted it.

So first of all, to Flabberghasted: thank you.

Secondly, while he gets points for consistency and obedience to Jesus. Unfortunately, I maintain that my point still stands, and being a doormat is still not a good long-term strategy for Christians. So minus a bunch of points for that.

I haven’t decided yet what to do with the card. As I said, I just got it, and am considering my options.